version
PlantPromoterDB promoter information of AK067197

Summary of Gene (AK067197)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0559900        NCBI 
Gene model AK067197  
Description tRNA-binding arm domain containing protein.  
#
#

Overview

Focused view (chromosome 5: 27959663-27958464)

Genome position     
from initiation codon
J013074C15          
J013098O16          
J033030M01          
J090058H12          
J090075M06          
TSS from cDNA
TSS information
AK067197                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067197

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-27959108-445

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACATGGGCCGTC-2795919927959210-536-547
 OsREG437ACATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG584    GGGCCGTC PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCAAGGCCCAAAC-2795922227959239-559-576
 OsREG582GAAGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG459  AGCCCAAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG497      CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430       AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471        AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625         GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593          GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCTA-2795924627959256-583-593
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGGGGCCTGGCCCAAG-2795928527959298-622-635
 OsREG524GGGCCTGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG577    CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG659     TGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581      GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCAAAT-2795930927959319-646-656
 OsREG591GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.