version
PlantPromoterDB promoter information of AK067351

Summary of Gene (AK067351)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0869000        NCBI 
Gene model AK067351  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 39417895-39416696)

Genome position     
from initiation codon
                    
AK121602            
J013109A17          
J033041A14          
J033107C15          
Os01g0869100        
TSS from cDNA
TSS information
AK067351                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067351

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-39417081-186

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCC-3941705939417067-164-172
Y PatchTCTTCCCC-3941710439417111-209-216
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGGTGGGGCCCACCGCCCACGCCCAAAC-3941715939417187-264-292
 OsREG528CGGGTGGG                      PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC                    PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC                   PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC                PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGCCCACC               PPDB MotifGCCCA  PLACE Motif 
 OsREG602               GCCCACGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG593                     GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCTGACAGG-3941722839417235-333-340
 OsREG551CTGACAGG PPDB Motif  PLACE MotifTGAC 
REGTTTCGGCCCATCC-3941724539417257-350-362
 OsREG634TTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590    GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG608     GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGGGCTGGGC-3941731139417318-416-423
 OsREG603GGCTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTGGGGGATG-3941735639417364-461-469
 OsREG482TGGGGGAT  PPDB Motif  PLACE Motif 
 OsREG516 GGGGGATG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.