version
PlantPromoterDB promoter information of AK067383

Summary of Gene (AK067383)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0120000        NCBI 
Gene model AK067383  
Description Protein prenyltransferase domain containing protein.  
#
#

Overview

Focused view (chromosome 2: 1051070-1049871)

Genome position     
from initiation codon
AK060220            
AK101590            
AK103704            
J013100B15          
J100042B05          
J100043J12          
J100051N24          
J100057N12          
J100066N11          
J100087E17          
TSS from cDNA
TSS information
AK067383                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067383

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-1050120-50

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACTGGGC-10501601050167-90-97
 OsREG604TACTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGTGGTGGGCCTATTTGGGCTGA-10501751050196-105-126
 OsREG527GTGGTGGG               PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG472   GTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG656    TGGGCCTA           PPDB MotifGCCCA  PLACE Motif 
 OsREG493           ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG457            TTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511             TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657              TGGGCTGA PPDB MotifGCCCA  PLACE Motif 
REGGTGGGTCC-10502181050225-148-155
 OsREG622GTGGGTCC PPDB MotifGGGACCC  PLACE Motif 
REGAACTGGGCCCCA-10502541050265-184-195
 OsREG425AACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.