version
PlantPromoterDB promoter information of AK067527

Summary of Gene (AK067527)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0784600        NCBI 
Gene model AK067527  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 1: 34999986-35001185)

Genome position     
from initiation codon
016-026-F07         
J013109O21          
J075002P08          
J075003E01          
J075036P20          
J075046P16          
J075057H01          
J075058L08          
J075103C12          
J075104M02          
J075119L05          
J075124H01          
J075128K24          
J075155E02          
J075158H09          
J075191I05          
J090037M22          
J090066E13          
TSS from cDNA
TSS information
AK067527                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067527

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+35000623-363

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAAAT+3500033635000343-650-643
 OsREG493GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCC+3500036135000368-625-618
 OsREG615GCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCTAATGGGCCTA+3500044835000466-538-520
 OsREG437ACATGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG610        TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431         AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474          ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656           TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCATAT+3500048035000490-506-496
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCAGG+3500049835000507-488-479
 OsREG660TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550  GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGGGACGGCT+3500054935000556-437-430
 OsREG468GGACGGCT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.