version
PlantPromoterDB promoter information of AK067774

Summary of Gene (AK067774)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0533900        NCBI 
Gene model AK067774  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 21813194-21811995)

Genome position     
from initiation codon
003-104-E05         
012-076-C03         
AK100449            
J013048F07          
J023026E11          
J023028B20          
J023050P11          
J023052K08          
J023075J03          
J023078E15          
J023090P12          
J023120E01          
J023142K01          
J033027K23          
J033058A09          
J033058C12          
J033125A04          
J043040L01          
J053061D06          
J053096N13          
J065193H10          
J090075L17          
J100050D10          
TSS from cDNA
TSS information
AK067774                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067774

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-21812293-99
TSS clone peakGclone-21812251-57

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCACGCGAGCCCATCC-2181229321812313-99-119
 OsREG421AAAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG463  AGCCCACG            PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG530    CCCACGCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG466            AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG608             GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGCCACCAAC-2181232121812328-127-134
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCCCCCGCG-2181236521812372-171-178
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGTGGCCCACCACGCCTCGGCCCCACCCG-2181242421812451-230-257
 OsREG653GTGGCCCA                     PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG503         CACGCCTC            PPDB Motif  PLACE Motif 
 OsREG575              CTCGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG631                 GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612                  GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG528                    CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCACACACCCCCACGCG-2181247921812494-285-300
 OsREG499CACACACC         PPDB Motif  PLACE Motif 
 OsREG536      CCCCCACG   PPDB Motif  PLACE Motif 
 OsREG530        CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCG-2181253821812545-344-351
 OsREG568TCGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGCACACACC-2181258021812587-386-393
 OsREG499CACACACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.