version
PlantPromoterDB promoter information of AK067807

Summary of Gene (AK067807)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0181600        NCBI 
Gene model AK067807  
Description Similar to GATA transcription factor 25 (ZIM-like 2 protein).  
#
#

Overview

Focused view (chromosome 3: 4250702-4251901)

Genome position     
from initiation codon
AK101197            
J013120L22          
J033030K10          
J033044L17          
J033088I12          
TSS from cDNA
TSS information
AK067807                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067807

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+4251209-493

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC+42512274251234-475-468
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACTGACAG+42509994251006-703-696
 OsREG453ACTGACAG PPDB Motif  PLACE MotifTGAC 
REGGATCGGAC+42510114251018-691-684
 OsREG589GATCGGAC PPDB Motif  PLACE Motif 
REGTAAGCCCACCAACGGCT+42510574251073-645-629
 OsREG655TAAGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG520     CCACCAAC     PPDB MotifCCAACGG  PLACE Motif 
 OsREG518        CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG469         CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGTCCGGCCCATAA+42510754251086-627-616
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605    GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCAACT+42511214251132-581-570
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479    GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAAGCGGCCCACCA+42511434251160-559-542
 OsREG459AGCCCAAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG618       GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564        CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628         GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599          GCCCACCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.