version
PlantPromoterDB promoter information of AK067825

Summary of Gene (AK067825)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0201600        NCBI 
Gene model AK067825  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 5352177-5350978)

Genome position     
from initiation codon
AK065564            
J013032C08          
J013100B14          
J033026O13          
J065015F13          
J065020J21          
J065147L21          
J065163E05          
TSS from cDNA
TSS information
AK067825                         5'->3' (-)
Promoter sequence










 
AK102580            
J033074G08          
J033098B09          
J100048D12          
J100049K21          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067825

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-5351305-128
TSS clone peakGclone-5351304-127

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCTCTCC-53512805351291-103-114
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGGGGCCCACCTGTC-53513805351396-203-219
 OsREG612GGTGGGGC          PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC         PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC     PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG514       CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+5351971AK102580, J100049K21, AK102580, J033098B09, J100048D12, J065068H09

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTTCGGCC+53517175351724AK102580, J033098B09, J065068H09, J100048D12, J100049K21
 OsREG634TTTCGGCC PPDB Motif  PLACE Motif 
REGGGTGGGGC+53517515351758AK102580, J033098B09, J065068H09, J100048D12, J100049K21
 OsREG612GGTGGGGC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.