version
PlantPromoterDB promoter information of AK067833

Summary of Gene (AK067833)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0740300        NCBI 
Gene model AK067833  
Description AAA ATPase domain containing protein.  
#
#

Overview

Focused view (chromosome 2: 31853014-31851815)

Genome position     
from initiation codon
011-024-E07         
011-064-F01         
AK070261            
AK099325            
J013122E14          
J033088M13          
J065067D23          
J065073N21          
J065132O20          
J065155B11          
J065198L12          
J090013C19          
J090080G12          
J100070D05          
TSS from cDNA
TSS information
AK067833                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067833

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-31852083-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGTGGGC-3185213831852146-124-132
 OsREG529TTCGTGGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601 TCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATTTTGGGCCTG-3185222031852238-206-224
 OsREG655TAAGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT           PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT          PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT         PPDB MotifGCCCA  PLACE Motif 
 OsREG592        TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625         TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471          TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513           TGGGCCTG PPDB MotifGCCCA  PLACE Motif 
REGTTCGGCCCATAT-3185224331852254-229-240
 OsREG642TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480    GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGGCCTG-3185225931852268-245-254
 OsREG629TCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513  TGGGCCTG PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGTT-3185227431852281-260-267
 OsREG424GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.