version
PlantPromoterDB promoter information of AK067845

Summary of Gene (AK067845)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0531600        NCBI 
Gene model AK067845  
Description Phospholipid/glycerol acyltransferase domain containing protein.  
#
#

Overview

Focused view (chromosome 7: 21473594-21472395)

Genome position     
from initiation codon
015-098-E11         
J013124G01          
J065008E15          
J065052K14          
J065052L13          
J065058M02          
J065069M10          
J065135A14          
J065168O18          
J065189C14          
J065205M03          
J075070D14          
J075169B16          
TSS from cDNA
TSS information
AK067845                         5'->3' (-)
Promoter sequence








 
AK071504            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067845

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-21472638-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC-2147265721472664-63-70
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGGCCCACCCG-2147275521472766-161-172
 OsREG647GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600   GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528    CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCCACCTGTC-2147277421472789-180-195
 OsREG478AGTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC     PPDB MotifGCCCA  PLACE Motif 
 OsREG476     GCCCACCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG514      CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501        CACCTGTC PPDB Motif  PLACE Motif 
REGCCGAGCCGGCCCATGT-2147279921472814-205-220
 OsREG540CCGAGCCG         PPDB Motif  PLACE Motif 
 OsREG615    GCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542     CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490      CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517       GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437        GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCGA-2147283721472847-243-253
 OsREG437ACATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA PPDB MotifGCCCA  PLACE Motif 
REGGCGACGCG-2147287721472884-283-290
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.