version
PlantPromoterDB promoter information of AK067917

Summary of Gene (AK067917)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0141300        NCBI 
Gene model AK067917  
Description Major sperm protein domain containing protein.  
#
#

Overview

Focused view (chromosome 8: 2304035-2305234)

Genome position     
from initiation codon
AK058337            
J065099J18          
J065108B09          
J065216F21          
J100039I03          
TSS from cDNA
TSS information
AK067917                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067917

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2304812-223
TSS clone peakAclone+2304824-211

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCCTCC+23048492304859-186-176
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGTGGGCCCCACC+23047142304728-321-307
 OsREG527GTGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612       GCCCCACC PPDB Motif  PLACE Motif 
REGGTGTGGGGCCCACCA+23047442304758-291-277
 OsREG535GTGTGGGG        PPDB Motif  PLACE Motif 
 OsREG611 TGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631  GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641   TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647    GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599       GCCCACCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.