version
PlantPromoterDB promoter information of AK068013

Summary of Gene (AK068013)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0594800        NCBI 
Gene model AK068013  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 29704542-29703343)

Genome position     
from initiation codon
011-025-D06         
AK058332            
J013129L24          
TSS from cDNA
TSS information
AK068013                         5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK068013

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-29704503-961
TSS clone peakGclone-29704483-941

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCTCTCCTCCC-2970446529704477-923-935
Y PatchTCCCCCTCCC-2970452129704530-979-988
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCAGCCCACCA-2970454929704564-1007-1022
 OsREG582GAAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG462       AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599        GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCAGC-2970457029704579-1028-1037
 OsREG523CCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGGCGTGGGC-2970458829704595-1046-1053
 OsREG602GCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGGGCTTTTATATGGGCCAT-2970460129704619-1059-1077
 OsREG419GGGCTTTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG480        ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630         TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488          ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487           TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGGGAGTGGG-2970475029704757-1208-1215
 OsREG532GGAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGGCCGGC-2970478129704791-1239-1249
 OsREG539CCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG615   GGGCCGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.