version
PlantPromoterDB promoter information of AK068045

Summary of Gene (AK068045)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0130500        NCBI 
Gene model AK068045  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 1637252-1638451)

Genome position     
from initiation codon
AK066085            
AK066229            
J013050A21          
J013058J02          
TSS from cDNA
TSS information
AK068045                         5'->3' (+)
Promoter sequence












 
AK069319            
J090067E13          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK068045

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+1638248-4
TSS clone peakGclone+1638250-2

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATGGGCT+16381431638151-109-101
 OsREG610TAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAA+16381751638209-77-43
 OsREG609TCATGGGC                            PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC                           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474  ATGGGCCT                          PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA                         PPDB MotifGCCCA  PLACE Motif 
 OsREG422           AAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG432            AATGGGCT                PPDB MotifGCCCA  PLACE Motif 
 OsREG491             ATGGGCTG               PPDB MotifGCCCA  PLACE Motif 
 OsREG523              TGGGCTGGGCTGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG533               GGGCTGGG             PPDB MotifGCCCA  PLACE Motif 
 OsREG603                GGCTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG464                 GCTGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG512                  CTGGGCTG          PPDB MotifGCCCA  PLACE Motif 
 OsREG457                           AGCCCAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-1637467AK069319, AK069319

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCCT-16374401637451AK069319
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.