version
PlantPromoterDB promoter information of AK068490

Summary of Gene (AK068490)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0104000        NCBI 
Gene model AK068490  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 6: 282137-280938)

Genome position     
from initiation codon
J013155I22          
J065060I05          
J065215K21          
J090078C18          
TSS from cDNA
TSS information
AK068490                         5'->3' (-)
Promoter sequence















 
AK109910            
J065049P20          
J065199K07          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK068490

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-281165-28

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCT-281127281134103
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTTGGGC-281218281225-81-88
 OsREG595GGTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGACGTGGC-281237281244-100-107
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCACGTGCCACGGCCCGGCCCGGCCCATGA-281254281284-117-147
 OsREG507GCCACGTG                        PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG521        CCACGGCC                PPDB Motif  PLACE Motif 
 OsREG504         CACGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG446          ACGGCCCG              PPDB MotifACGGGC  PLACE Motif 
 OsREG544           CGGCCCGGCCCGG        PPDB Motif  PLACE Motif 
 OsREG616            GGCCCGGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614             GCCCGGCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538              CCCGGCCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542                    CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490                     CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517                      GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609                       GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGACTGGGCCGTT-281300281310-163-173
 OsREG454ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423   GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
REGCGGATCGG-281394281401-257-264
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.