version
PlantPromoterDB promoter information of AK068710

Summary of Gene (AK068710)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0189300        NCBI 
Gene model AK068710  
Description Isocitrate lyase and phosphorylmutase family protein.  
#
#

Overview

Focused view (chromosome 12: 4497926-4499125)

Genome position     
from initiation codon
J013159K10          
J075097D02          
J090013D24          
J090045C04          
TSS from cDNA
TSS information
AK068710                         5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK068710

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+4498793-133

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCTCTATATAAATC+44987564498769-170-157
Y PatchTCCTCCTCCTCCCCTCCT+44987684498785-158-141
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACACG+44986764498683-250-243
 OsREG573GCCACACG PPDB Motif  PLACE Motif 
REGGTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCC+44987084498746-218-180
 OsREG502GTGGCGTG                                PPDB Motif  PLACE Motif 
 OsREG602   GCGTGGGC                             PPDB MotifGCCCA  PLACE Motif 
 OsREG571    CGTGGGCC                            PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC                           PPDB MotifGCCCA  PLACE Motif 
 OsREG647      TGGGCCCC                          PPDB MotifGCCCA  PLACE Motif 
 OsREG641       GGGCCCCA                         PPDB MotifGCCCA  PLACE Motif 
 OsREG631        GGCCCCAC                        PPDB Motif  PLACE Motif 
 OsREG532           CCCACTCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG538                 CCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542                  CCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG564                   CGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628                    GGCCCACC            PPDB MotifGCCCA  PLACE Motif 
 OsREG599                     GCCCACCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG524                          CCAGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG513                           CAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG473                            AGGCCCAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG620                             GGCCCAGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG603                              GCCCAGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG533                               CCCAGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.