version
PlantPromoterDB promoter information of AK068867

Summary of Gene (AK068867)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0741500        NCBI 
Gene model AK068867  
Description Ribbon-helix-helix domain containing protein.  
#
#

Overview

Focused view (chromosome 2: 31921278-31920079)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK068867                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK068867

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-31920466-188

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCC-3192047431920481-196-203
Y PatchCCTCCTCTC-3192048331920491-205-213
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCGTCC-3192052031920527-242-249
 OsREG442ACGCGTCC PPDB Motif  PLACE Motif 
REGCCATGGGCCTTGGGCCGAG-3192054531920563-267-285
 OsREG525CCATGGGC            PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474  ATGGGCCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT         PPDB MotifGCCCA  PLACE Motif 
 OsREG497    GGGCCTTG        PPDB MotifGCCCA  PLACE Motif 
 OsREG581        CTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563         TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658          TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG575           GGGCCGAG PPDB MotifGCCCA  PLACE Motif 
REGCAGGCCCACCA-3192057031920580-292-302
 OsREG513CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCAAAC-3192060831920619-330-341
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCAGC-3192062231920631-344-353
 OsREG582GAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGCACGCCAC-3192064531920652-367-374
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGACAGCCCACAA-3192066631920676-388-398
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.