version
PlantPromoterDB promoter information of AK069143

Summary of Gene (AK069143)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0175700        NCBI 
Gene model AK069143  
Description Nonaspanin (TM9SF) family protein.  
#
#

Overview

Focused view (chromosome 12: 3853923-3855122)

Genome position     
from initiation codon
J023004K23          
J065057F23          
J065070C18          
J065071M12          
J065091I06          
J065166P12          
J075172I01          
J075175I03          
J075192J12          
J090059N07          
J090089D13          
J100068O11          
J100090F05          
TSS from cDNA
TSS information
AK069143                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069143

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+3854871-52

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCGACGGCCGTCCAAGCCCACCCG+38547633854788-160-135
 OsREG483ATCCGACG                   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG                  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG624       GGCCGTCC            PPDB Motif  PLACE Motif 
 OsREG519             CCAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG496              CAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427               AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462                AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600                 GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528                  CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCCCCCACG+38548173854824-106-99
 OsREG536CCCCCACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.