version
PlantPromoterDB promoter information of AK069189

Summary of Gene (AK069189)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0616200        NCBI 
Gene model AK069189  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 11: 25818403-25819602)

Genome position     
from initiation codon
J023004N19          
TSS from cDNA
TSS information
AK069189                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069189

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+25819328-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTCGGCCGCCACGT+2581910625819120-297-283
 OsREG635TCTCGGCC        PPDB Motif  PLACE Motif 
 OsREG448       CGCCACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGATTTGGGCCGAAAGCCCAAAA+2581916625819186-237-217
 OsREG493ATTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG634     GGCCGAAA         PPDB Motif  PLACE Motif 
 OsREG421          AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426           AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457            AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592             GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCT+2581920425819212-199-191
 OsREG480ATATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGCCCATCT+2581922025819227-183-176
 OsREG456GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCTGC+2581923225819242-171-161
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG591   TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCTTTCGGCCCAAAT+2581926125819281-142-122
 OsREG480ATATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG634        TTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG642         TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658          TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563           CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625            GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493             GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.