version
PlantPromoterDB promoter information of AK069343

Summary of Gene (AK069343)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0486000        NCBI 
Gene model AK069343  
Description Similar to MSH4.  
#
#

Overview

Focused view (chromosome 7: 18529783-18530982)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK069343                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069343

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+18530719-64

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGGTATAAAAG+1853068518530695-98-88
Y PatchCTCTCCTCCTCCCC+1853072918530742-54-41
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGATGGGCCAGA+1853057018530581-213-202
 OsREG608GGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCTTC+1853058518530595-198-188
 OsREG596TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCCACGTG+1853060918530623-174-160
 OsREG476AGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571     GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG449      GCCCACGT  PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508       CCCACGTG PPDB MotifACGT  PLACE Motif 
REGACAGCCCACTCC+1853063218530643-151-140
 OsREG435ACAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG532    CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCCAGGCCC+1853066318530678-120-105
 OsREG422AAATGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG     PPDB MotifGCCCA  PLACE Motif 
 OsREG550     GGCCCAGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG524        CCAGGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.