version
PlantPromoterDB promoter information of AK069525

Summary of Gene (AK069525)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0509200        NCBI 
Gene model AK069525  
Description Similar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1).  
#
#

Overview

Focused view (chromosome 9: 20405540-20406739)

Genome position     
from initiation codon
J013108J19          
J013109C02          
J013118I11          
J013129E18          
J013157C19          
J013169N14          
J023007C18          
J023022P15          
J023027G22          
J023045A22          
J023080M05          
J023133D01          
J023139O12          
J033114C17          
J033148N06          
J033150A07          
J080301A20          
J080315M24          
J090062A15          
J090084L12          
J100027P10          
J100032J19          
J100038M16          
J100048E06          
J100050P17          
J100084P07          
TSS from cDNA
TSS information
AK069525                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069525

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+20406353-187

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTCCCCTCCC+2040635820406371-182-169
Y PatchTCTCCTCTCTCTCTCTC+2040638520406401-155-139
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCATCA+2040616520406175-375-365
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGCCCAATT+2040619520406208-345-332
 OsREG615GGGCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563    CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492     GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433      GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGGGCTGGGCCTTTGGGCCAA+2040622320406241-317-299
 OsREG603GGCTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG620 GCTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG473  CTGGGCCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT         PPDB MotifGCCCA  PLACE Motif 
 OsREG625         TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659          TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660           TGGGCCAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.