version
PlantPromoterDB promoter information of AK069530

Summary of Gene (AK069530)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0464000        NCBI 
Gene model AK069530  
Description Similar to Carbonate dehydratase-like protein.  
#
#

Overview

Focused view (chromosome 9: 18226059-18224860)

Genome position     
from initiation codon
AK060777            
J013037H12          
J023022G09          
J065027F16          
J065030P17          
J065039M21          
J065050F10          
J065051E09          
J065077G21          
J065123M02          
J065138M23          
J065174A08          
J065198G22          
J065199L06          
J065200A19          
J075059O13          
J075064N23          
J075065A07          
J075104I19          
J075122D07          
J075142D14          
J075159E22          
J075185C19          
J090078O11          
TSS from cDNA
TSS information
AK069530                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069530

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-18225250-191
TSS clone peakAclone-18225121-62

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCACGTG-1822531218225321-253-262
 OsREG536CCCCCACG   PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT  PPDB MotifACGT  PLACE Motif 
 OsREG508  CCCACGTG PPDB MotifACGT  PLACE Motif 
REGCGGACGGAC-1822533118225339-272-280
 OsREG561CGGACGGA  PPDB Motif  PLACE Motif 
 OsREG623 GGACGGAC PPDB Motif  PLACE Motif 
REGATCCAACGGCC-1822536418225374-305-315
 OsREG481ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG494   CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGCCCACTCT-1822538918225396-330-337
 OsREG455CCCACTCT PPDB Motif  PLACE Motif 
REGACATGGGCCCACGA-1822540518225418-346-359
 OsREG437ACATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC      PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571     GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601      GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCCCAG-1822542018225432-361-373
 OsREG610TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG580     GGCCCCAG PPDB Motif  PLACE Motif 
REGTGCGGCCCATG-1822543718225447-378-388
 OsREG643TGCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGCCCACAC-1822546618225473-407-414
 OsREG598GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGGCCCAGTT-1822548918225496-430-437
 OsREG425GCCCAGTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.