version
PlantPromoterDB promoter information of AK069619

Summary of Gene (AK069619)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0513400        NCBI 
Gene model AK069619  
Description Protein of unknown function DUF789 family protein.  
#
#

Overview

Focused view (chromosome 1: 19780990-19782189)

Genome position     
from initiation codon
015-046-E05         
J023003B18          
J023025D18          
J023042C12          
J023121K09          
J075027K23          
J075087J01          
J100029C19          
J100035D09          
TSS from cDNA
TSS information
AK069619                         5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069619

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+19781778-212

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCTATAAATG+1978174019781750-250-240
Y PatchCCTCCTCCTCTT+1978172919781740-261-250
Y PatchCTTCCTCTCC+1978177519781784-215-206
Y PatchTCCTCCTCTCCTCTTCCCC+1978179919781817-191-173
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGACAGGTGGGCCCCACG+1978160619781624-384-366
 OsREG551CTGACAGG            PPDB Motif  PLACE MotifTGAC 
 OsREG501  GACAGGTG          PPDB Motif  PLACE Motif 
 OsREG436   ACAGGTGG         PPDB Motif  PLACE Motif 
 OsREG514    CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476     AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647        TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641         GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631          GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572           GCCCCACG PPDB Motif  PLACE Motif 
REGCGCGGGGG+1978162719781634-363-356
 OsREG537CGCGGGGG PPDB Motif  PLACE Motif 
REGGGGGCCCACCCG+1978164119781652-349-338
 OsREG647GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600   GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528    CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCTCGCGCG+1978167919781686-311-304
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 
REGCCCCCGCG+1978170619781713-284-277
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.