version
PlantPromoterDB promoter information of AK069658

Summary of Gene (AK069658)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0708600        NCBI 
Gene model AK069658  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 29332674-29331475)

Genome position     
from initiation codon
AK069199            
J023008E04          
J023030D22          
J033027E16          
J033046D09          
J033068I10          
J033135A12          
J065027E22          
J065191K23          
J090054D15          
J090058J15          
TSS from cDNA
TSS information
AK069658                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069658

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-29331737-63

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCC-2933170829331715-34-41
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCCAAG-2933178129331791-107-117
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCAAAT-2933181329331824-139-150
 OsREG504CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493    GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGATCTGGGC-2933183129331838-157-164
 OsREG486ATCTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCAAAC-2933188229331892-208-218
 OsREG496CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.