version
PlantPromoterDB promoter information of AK069775

Summary of Gene (AK069775)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0329800        NCBI 
Gene model AK069775  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 9: 10391132-10392331)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK069775                         5'->3' (+)
Promoter sequence








 
Os09g0329700        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069775

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+10392131-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCTC+10392147103921541522
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCTAACAGCCCATAT+1039184510391866-287-266
 OsREG592TTTTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA            PPDB MotifGCCCA  PLACE Motif 
 OsREG435           ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491            CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465             AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480              GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGC+1039196010391967-172-165
 OsREG615GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGGC+1039200510392013-127-119
 OsREG538GGGCCGGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG614 GGCCGGGC PPDB Motif  PLACE Motif 
REGCGGGCCGATGGGCCAGGCCC+1039205010392069-82-63
 OsREG568CGGGCCGA             PPDB MotifACGGGC  PLACE Motif 
 OsREG553     CGATGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG590      GATGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG488       ATGGGCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG577        TGGGCCAG     PPDB MotifGCCCA  PLACE Motif 
 OsREG524            CCAGGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.