version
PlantPromoterDB promoter information of AK069984

Summary of Gene (AK069984)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0775200        NCBI 
Gene model AK069984  
Description Similar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5).  
#
#

Overview

Focused view (chromosome 2: 33615291-33614092)

Genome position     
from initiation codon
AB038319            
J023036N01          
J053064C01          
J065057A06          
J065098G16          
J065137O06          
J065162D05          
J065169P22          
J065180J12          
J065205K11          
J100039N18          
TSS from cDNA
TSS information
AK069984                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK069984

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-33614419-128

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCCTC-3361439233614401-101-110
Y PatchCCTCCTCC-3361443333614440-142-149
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGGGCTGGGCCCATA-3361445933614476-168-185
 OsREG422AAATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG         PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG620      GCTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579       CTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG489         GGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630          GGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCAGTT-3361448633614496-195-205
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454  GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG425   GCCCAGTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.