version
PlantPromoterDB promoter information of AK070047

Summary of Gene (AK070047)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0952600        NCBI 
Gene model AK070047  
Description Similar to LacZ (Fragment).  
#
#

Overview

Focused view (chromosome 1: 43748844-43750043)

Genome position     
from initiation codon
J013050N22          
J013072N14          
J023038J20          
J023078B19          
J033095H22          
J033108A13          
J065046D16          
J065122F03          
J065197C16          
J065217I12          
J075096G01          
TSS from cDNA
TSS information
AK070047                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070047

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+43749530-314

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTGGTGGGCTTA+4374926243749274-582-570
 OsREG520GTTGGTGG      PPDB MotifCCAACGG  PLACE Motif 
 OsREG599  TGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462   GGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG427    GTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655     TGGGCTTA PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGAA+4374928043749287-564-557
 OsREG642GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCAGA+4374929643749305-548-539
 OsREG430AAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCCATAC+4374936743749379-477-465
 OsREG581CTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639 TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489   GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630    GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606     GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGACCGGGCCCACCC+4374941243749424-432-420
 OsREG441ACCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600     GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGCAGGTGGGGCCCAGAT+4374945743749472-387-372
 OsREG514CAGGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG579      GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629       GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486        GCCCAGAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.