version
PlantPromoterDB promoter information of AK070255

Summary of Gene (AK070255)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0130400        NCBI 
Gene model AK070255  
Description Adenylate kinase, subfamily protein.  
#
#

Overview

Focused view (chromosome 3: 1693914-1695113)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK070255                         5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070255

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+1694840-74

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGATCGG+16946121694619-302-295
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGCCCCCACG+16946251694632-289-282
 OsREG536CCCCCACG PPDB Motif  PLACE Motif 
REGCGTGTGGGACC+16946411694651-273-263
 OsREG526CGTGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG650   GTGGGACC PPDB MotifGGGACCC  PLACE Motif 
REGTCGTGGGCCCC+16946691694679-245-235
 OsREG601TCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGGACAGGTGGGACC+16947401694752-174-162
 OsREG501GACAGGTG      PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG     PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG651    GGTGGGAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650     GTGGGACC PPDB MotifGGGACCC  PLACE Motif 
REGGGTCCACGCCTC+16947761694787-138-127
 OsREG570GGTCCACG     PPDB Motif  PLACE Motif 
 OsREG636  TCCACGCC   PPDB Motif  PLACE Motif 
 OsREG503    CACGCCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.