version
PlantPromoterDB promoter information of AK070272

Summary of Gene (AK070272)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0200400        NCBI 
Gene model AK070272  
Description Thioredoxin domain 2 containing protein.  
#
#

Overview

Focused view (chromosome 1: 5442579-5441380)

Genome position     
from initiation codon
006-024-C04         
AK104558            
J023043M23          
J043001A15          
J065155O20          
J065183G02          
J090007F17          
J090034P12          
J090098G24          
TSS from cDNA
TSS information
AK070272                         5'->3' (-)
Promoter sequence













 
AK068290            
J013151I06          
J043035H02          
J075057N10          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070272

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-5441613-34

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGATGGGCCCACCTGTCAGTGG-54417775441798-198-219
 OsREG456AGATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC          PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT         PPDB MotifGCCCA  PLACE Motif 
 OsREG514       CCCACCTG        PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT       PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC      PPDB Motif  PLACE Motif 
 OsREG551           CCTGTCAG    PPDB Motif  PLACE MotifTGAC 
 OsREG453            CTGTCAGT   PPDB Motif  PLACE MotifTGAC 
 OsREG510             TGTCAGTG  PPDB Motif  PLACE MotifTGAC 
 OsREG522              GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGTGTCAGTG-54418335441840-254-261
 OsREG510TGTCAGTG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.