version
PlantPromoterDB promoter information of AK070286

Summary of Gene (AK070286)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0672600        NCBI 
Gene model AK070286  
Description Similar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2.  
#
#

Overview

Focused view (chromosome 2: 28246362-28247561)

Genome position     
from initiation codon
AK101174            
J065081G17          
J065122O03          
J065168D02          
J065196N22          
J075140L04          
TSS from cDNA
TSS information
AK070286                         5'->3' (+)
Promoter sequence






 
AK109266            
AK110845            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070286

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+28247308-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCGGCC+2824717728247184-185-178
 OsREG634TTTCGGCC PPDB Motif  PLACE Motif 
REGTATTGGGCCCGC+2824718828247199-174-163
 OsREG596TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG  PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619    GGGCCCGC PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCT+2824721828247226-144-136
 OsREG422AAATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGGCCGGGCCGTG+2824724028247251-122-111
 OsREG614GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616 GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544  CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446   CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG504    GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGCGCCACGT+2824725628247263-106-99
 OsREG448CGCCACGT PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-28246521AK109266
TSS clone peakAclone-28246518AK109266

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCTCTCTT-2824655028246560AK109266
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCGTCGCG-2824666928246676AK109266
 OsREG556GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGACCGGCCCACAC-2824670828246719AK109266
 OsREG440ACCGGCCC     PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598    GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGCCACGGCCCACCT-2824672128246733AK109266
 OsREG521CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564   CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476     GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGGGCCGAGA-2824678428246791AK109266
 OsREG635GGCCGAGA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.