version
PlantPromoterDB promoter information of AK070319

Summary of Gene (AK070319)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0638800        NCBI 
Gene model AK070319  
Description Protein of unknown function DUF617, plant family protein.  
#
#

Overview

Focused view (chromosome 4: 32862596-32863795)

Genome position     
from initiation codon
AK071753            
TSS from cDNA
TSS information
AK070319                         5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070319

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+32863471-125
TSS clone peakGclone+32863474-122

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCCC+3286345132863458-145-138
Y PatchCCTTCTCC+3286346232863469-134-127
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTGGGCTGA+3286317232863181-424-415
 OsREG457TTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511 TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657  TGGGCTGA PPDB MotifGCCCA  PLACE Motif 
REGTGATGGGCT+3286322332863231-373-365
 OsREG607TGATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCATCA+3286324032863250-356-346
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGCACCGCACGCG+3286329532863305-301-291
 OsREG500CACCGCAC    PPDB Motif  PLACE Motif 
 OsREG555   CGCACGCG PPDB Motif  PLACE Motif 
REGGCCCAAAC+3286339632863403-200-193
 OsREG593GCCCAAAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.