version
PlantPromoterDB promoter information of AK070512

Summary of Gene (AK070512)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0181000        NCBI 
Gene model AK070512  
Description Similar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40).  
#
#

Overview

Focused view (chromosome 7: 4298034-4299233)

Genome position     
from initiation codon
012-067-A05         
AK066918            
J013089N03          
J023055B17          
J090016G12          
J100071L19          
TSS from cDNA
TSS information
AK070512                         5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070512

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+4299033-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCCC+42989844298991-50-43
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGCCCAAAT+42988184298828-216-206
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCACGTGGCCCCACTCC+42989204298935-114-99
 OsREG507CACGTGGC         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG532        CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTCACC+42989404298950-94-84
 OsREG585GCCACGTC    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505  CACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447   ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.