version
PlantPromoterDB promoter information of AK070549

Summary of Gene (AK070549)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0846400        NCBI 
Gene model AK070549  
Description Peptidase, trypsin-like serine and cysteine domain containing protein.  
#
#

Overview

Focused view (chromosome 3: 36439666-36440865)

Genome position     
from initiation codon
AK067706            
J013031B01          
J013062D10          
J013097E14          
J013112K19          
J013151O06          
J023052H18          
J023057D01          
J023093D02          
J023112L10          
J023136H12          
J033092P16          
J033093I08          
J065120E24          
J090068H06          
TSS from cDNA
TSS information
AK070549                         5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070549

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+36440521-145

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGATGGGCCAC+3644026136440271-405-395
 OsREG553CGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGT+3644028236440289-384-377
 OsREG440GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGTGGTGGGCCGTGGCTGGGCTGG+3644030836440329-358-337
 OsREG599TGGTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT            PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG           PPDB MotifGCCCA  PLACE Motif 
 OsREG521     GGCCGTGG          PPDB Motif  PLACE Motif 
 OsREG603           GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG464            GCTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG512             CTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523              TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCATGGGCCGGATCGGCCCGGC+3644033436440360-332-306
 OsREG591GCAGCCCA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT                   PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG                  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGGGC               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517      CATGGGCC              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490       ATGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG542        TGGGCCGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG644         GGGCCGGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG541             CGGATCGG       PPDB Motif  PLACE Motif 
 OsREG568                 TCGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544                  CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG616                   GGCCCGGC PPDB Motif  PLACE Motif 
REGCGGGCCGTGCCCGGCCC+3644037436440390-292-276
 OsREG446CGGGCCGT          PPDB MotifACGGGC  PLACE Motif 
 OsREG504 GGGCCGTG         PPDB MotifGCCCA  PLACE Motif 
 OsREG614        GCCCGGCC  PPDB Motif  PLACE Motif 
 OsREG538         CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGCTGGGCCGTGTCTGGGCCGGGCCGTG+3644039836440424-268-242
 OsREG620GCTGGGCC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   CTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT                  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504   GGGCCGTG        GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
 OsREG629           TCTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG542             TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538              GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614               GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616                GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544                 CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446                  CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.