version
PlantPromoterDB promoter information of AK070623

Summary of Gene (AK070623)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0969100        NCBI 
Gene model AK070623  
Description NAD-dependent epimerase/dehydratase family protein.  
#
#

Overview

Focused view (chromosome 1: 44537853-44536654)

Genome position     
from initiation codon
011-064-G09         
012-001-D01         
015-035-B07         
J023063F13          
J033034A13          
J033085E16          
J033096E02          
J033120P16          
J033126O21          
J033143A16          
J065152I09          
J090001N19          
TSS from cDNA
TSS information
AK070623                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070623

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-44537020-167

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCCT-4453705044537057-197-204
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGAGTGGGCCAC-4453708344537094-230-241
 OsREG532GGAGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654   GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653    TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCATGCAGGCCCACCAAC-4453711344537135-260-282
 OsREG587GAGGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT               PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG513          CAGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG472           AGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628            GGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG599             GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520               CCACCAAC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.