version
PlantPromoterDB promoter information of AK070657

Summary of Gene (AK070657)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0618700        NCBI 
Gene model AK070657  
Description Lung seven transmembrane receptor family protein.  
#
#

Overview

Focused view (chromosome 2: 25452100-25453299)

Genome position     
from initiation codon
J023056H15          
TSS from cDNA
TSS information
AK070657                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070657

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+25453036-64

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCCT+2545298725452996-113-104
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAGCCCATCAAGCCCATAT+2545274325452763-357-337
 OsREG533CCCAGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG523 CCAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG491  CAGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG466   AGCCCATC           PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG496          CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429           AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465            AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480             GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGCCCAGCCCAAAT+2545277525452787-325-313
 OsREG603GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533 CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523  CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511   CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457    AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493     GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCATTT+2545279325452803-307-297
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGCCCACCA+2545283525452842-265-258
 OsREG599GCCCACCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.