version
PlantPromoterDB promoter information of AK070712

Summary of Gene (AK070712)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0832200        NCBI 
Gene model AK070712  
Description Similar to Calcium-binding protein precursor (Calreticulin).  
#
#

Overview

Focused view (chromosome 3: 35807534-35806335)

Genome position     
from initiation codon
J023060M04          
J090030I12          
J090062M21          
TSS from cDNA
TSS information
AK070712                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070712

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-35806638-104

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTCAGTG-3580671735806724-183-190
 OsREG510TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGCCCGTGGGCCAG-3580672835806739-194-205
 OsREG531CCCGTGGG     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547 CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654   GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577    TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGCCCACGTGT-3580676035806768-226-234
 OsREG508CCCACGTG  PPDB MotifACGT  PLACE Motif 
 OsREG434 CCACGTGT PPDB MotifACGT  PLACE Motif 
REGGGCCGTGGGCCAT-3580677435806786-240-252
 OsREG521GGCCGTGG      PPDB Motif  PLACE Motif 
 OsREG547  CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571   CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654    GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487     TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGCGCGTCGC-3580683335806840-299-306
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGCACGTGGC-3580688635806893-352-359
 OsREG507CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.