version
PlantPromoterDB promoter information of AK070723

Summary of Gene (AK070723)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0661300        NCBI 
Gene model AK070723  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 4: 34146338-34145139)

Genome position     
from initiation codon
AK103942            
J080316J24          
TSS from cDNA
TSS information
AK070723                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070723

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-34145499-161
TSS clone peakGclone-34145413-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCC-3414548734145495-149-157
Y PatchTCCTCCTCCCCC-3414551534145526-177-188
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCCAC-3414550734145514-169-176
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGGCCCACCA-3414553034145537-192-199
 OsREG599GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGCGCACGCG-3414554734145554-209-216
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 
REGCGGATCGGACGG-3414557934145590-241-252
 OsREG541CGGATCGG     PPDB Motif  PLACE Motif 
 OsREG589  GATCGGAC   PPDB Motif  PLACE Motif 
 OsREG484   ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545    TCGGACGG PPDB Motif  PLACE Motif 
REGATCCGACGG-3414561134145619-273-281
 OsREG483ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGTCTGGACC-3414563734145644-299-306
 OsREG649TCTGGACC PPDB Motif  PLACE Motif 
REGCCCACGGGGCCCACAC-3414566834145683-330-345
 OsREG531CCCACGGG         PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG647     GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627       GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598        GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGGGTCCCAC-3414572334145730-385-392
 OsREG650GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGACAGCCCAACACGGCCCATGG-3414575934145779-421-441
 OsREG435ACAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC            PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA           PPDB MotifGCCCA  PLACE Motif 
 OsREG504         CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445          ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490           CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517            GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525             GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.