version
PlantPromoterDB promoter information of AK070776

Summary of Gene (AK070776)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0323100        NCBI 
Gene model AK070776  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 11763357-11762158)

Genome position     
from initiation codon
009-108-G02         
AK062803            
TSS from cDNA
TSS information
AK070776                         5'->3' (-)
Promoter sequence




 
AK067323            
J013002P04          
J013089D11          
J013095I19          
J013106B16          
J023002F23          
J023007D24          
J033048N23          
J065197K23          
J075052E17          
J075071O16          
J075088I24          
J075102N22          
J075114H10          
J075117C16          
J075139P07          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070776

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-11762567-210

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGTGTG-1176265511762662-298-305
 OsREG499GGTGTGTG PPDB Motif  PLACE Motif 
REGCGGGTGGGGCGTCGGATC-1176273311762750-376-393
 OsREG528CGGGTGGG           PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC         PPDB Motif  PLACE Motif 
 OsREG483         CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588          GTCGGATC PPDB MotifCCGAC  PLACE Motif 
REGGGAGTGGG-1176276111762768-404-411
 OsREG532GGAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGACCCGCGCGGGT-1176277411762785-417-428
 OsREG439ACCCGCGCGGGT PPDB Motif  PLACE Motif 
REGACGTGGGGG-1176278911762797-432-440
 OsREG450ACGTGGGG  PPDB MotifACGT  PLACE Motif 
 OsREG536 CGTGGGGG PPDB Motif  PLACE Motif 
REGCGACACGT-1176283011762837-473-480
 OsREG452CGACACGT PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+11762943AK067323, AK067323

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCTT+1176294511762953AK067323
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCACACACC+1176265511762662AK067323
 OsREG499CACACACC PPDB Motif  PLACE Motif 
REGGATCCGACGCCCCACCCG+1176273311762750AK067323
 OsREG588GATCCGAC           PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG          PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG612        GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG528          CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCCCACTCC+1176276111762768AK067323
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGACCCGCGCGGGT+1176277411762785AK067323
 OsREG439ACCCGCGCGGGT PPDB Motif  PLACE Motif 
REGCCCCCACGT+1176278911762797AK067323
 OsREG536CCCCCACG  PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT PPDB MotifACGT  PLACE Motif 
REGACGTGTCG+1176283011762837AK067323
 OsREG452ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.