version
PlantPromoterDB promoter information of AK070847

Summary of Gene (AK070847)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0821900        NCBI 
Gene model AK070847  
Description Similar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-).  
#
#

Overview

Focused view (chromosome 3: 35353051-35354250)

Genome position     
from initiation codon
J013030C24          
J013059F20          
J013158A05          
J023037A03          
J023064M04          
J023095H12          
J023141P22          
J065204C06          
J090091H04          
J090095C19          
TSS from cDNA
TSS information
AK070847                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070847

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+35353714-337

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTC+3535375435353762-297-289
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCCAT+3535343235353442-619-609
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487   TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATAA+3535346235353470-589-581
 OsREG465AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605 GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCTACCGGGCCAAAGCCCACA+3535347835353504-573-547
 OsREG478AGTGGGCC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT                   PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG441         ACCGGGCC           PPDB Motif  PLACE Motif 
 OsREG421                 AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG427                  AAGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG461                   AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGCACGTCAC+3535351135353518-540-533
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGGGCCCGGT+3535359635353603-455-448
 OsREG441GGCCCGGT PPDB Motif  PLACE Motif 
REGCACACACC+3535362335353630-428-421
 OsREG499CACACACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.