version
PlantPromoterDB promoter information of AK070908

Summary of Gene (AK070908)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0476800        NCBI 
Gene model AK070908  
Description Similar to TA5 protein (Fragment).  
#
#

Overview

Focused view (chromosome 4: 24271488-24270289)

Genome position     
from initiation codon
                    
J013099D15          
J013124F16          
J013162I21          
J023064I21          
J033023A18          
J033052I22          
J033072D08          
J033079C05          
J033090J05          
J033091J12          
J033147B20          
J043038O12          
J065186P14          
J075009C19          
J075013A09          
J075016F13          
J075025F18          
J075029L19          
J075031G02          
J075038D04          
J075069H09          
J075070M20          
J075102H19          
J075107N23          
J075117C11          
J075177H11          
J075178L08          
J075182P09          
J075190N18          
J075199I09          
J090009B03          
J090027E20          
J090039L08          
J090057B11          
J090060E11          
J090095I12          
J100067J15          
Os04g0476901        
TSS from cDNA
TSS information
AK070908                         5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK070908

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24270619-131

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCCC-2427063924270648-151-160
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACTGACAGGTGGGCCCAAAA-2427070424270724-216-236
 OsREG510CACTGACA              PPDB Motif  PLACE MotifTGAC 
 OsREG453 ACTGACAG             PPDB Motif  PLACE MotifTGAC 
 OsREG551  CTGACAGG            PPDB Motif  PLACE MotifTGAC 
 OsREG501    GACAGGTG          PPDB Motif  PLACE Motif 
 OsREG436     ACAGGTGG         PPDB Motif  PLACE Motif 
 OsREG514      CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476       AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628        GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639           GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625            GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592             GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGCACGCCAC-2427074124270748-253-260
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGCCACTGAC-2427085024270857-362-369
 OsREG522CCACTGAC PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.