version
PlantPromoterDB promoter information of AK071099

Summary of Gene (AK071099)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0710800        NCBI 
Gene model AK071099  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 1: 31289101-31287902)

Genome position     
from initiation codon
003-126-H05         
004-016-H04         
AK069577            
AK098952            
AK104373            
AK106129            
J013055J12          
J013055K12          
J013066L20          
J013067P22          
J013090L24          
J013149E22          
J023022J10          
J023044H09          
J023045D08          
J023073H10          
J023107N14          
J065147C24          
J065152H04          
J065208N15          
J065218D03          
J090088E24          
TSS from cDNA
TSS information
AK071099                         5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071099

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-31292009-308

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGTCCG-3129207131292079-370-378
 OsREG624GGCCGTCC  PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG PPDB Motif  PLACE Motif 
REGAGCCGTTGGAT-3129210131292111-400-410
 OsREG469AGCCGTTG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548  CCGTTGGA  PPDB MotifCCAACGG  PLACE Motif 
 OsREG481   CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGTTTTGGGCCTTAGGCCCATAT-3129225631292276-555-575
 OsREG592TTTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG656          TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630            GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480             GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGGTTGGGCTTGAAGCCCAAC-3129228831292307-587-606
 OsREG595GGTTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG          PPDB MotifGCCCA  PLACE Motif 
 OsREG582          GAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT   AGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.