version
PlantPromoterDB promoter information of AK071122

Summary of Gene (AK071122)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0143500        NCBI 
Gene model AK071122  
Description Glycosyl transferase, family 14 protein.  
#
#

Overview

Focused view (chromosome 8: 2387925-2389124)

Genome position     
from initiation codon
006-072-G06         
016-053-H02         
AK061094            
J023081E17          
J023106O18          
J043001N22          
J065062D05          
J065099M15          
J065180K12          
J090045L23          
J100088K05          
TSS from cDNA
TSS information
AK071122                         5'->3' (+)
Promoter sequence









 
015-006-A10         
AK066792            
AK120532            
J100083F02          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071122

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+2388732-193
TSS clone peakCclone+2388748-177

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTC+23886842388694-241-231
Y PatchTCTCTCTCCTCCT+23887242388736-201-189
Y PatchCTCTCTCC+23887442388751-181-174
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAGGTGGGCT+23884722388481-453-444
 OsREG514CAGGTGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG462  GGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGCGTGGGCCCACA+23884892388501-436-424
 OsREG602GCGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGCG+23885722388579-353-346
 OsREG555CGCGTGCG PPDB Motif  PLACE Motif 
REGTGGGGCCCACT+23885982388608-327-317
 OsREG641TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647 GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478   GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCGTT+23886232388634-302-291
 OsREG592TTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423    GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
REGTATTGGGCCTA+23886382388648-287-277
 OsREG596TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone-2388279AK120532, AK120532, J100083F02, 015-006-A10, AK066792

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCCC-23883192388326015-006-A10, AK066792, AK120532, J100083F02
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGCGGGCCCACCA-23883322388344015-006-A10, AK066792, AK120532, J100083F02
 OsREG632TGCGGGCC      PPDB Motif  PLACE Motif 
 OsREG619 GCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599     GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGCACTGACAAGTGGGACCCAC-23883802388399015-006-A10, AK066792, AK120532, J100083F02
 OsREG510CACTGACA             PPDB Motif  PLACE MotifTGAC 
 OsREG498      CAAGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG650         GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648          TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637           GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622            GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGAGCCCACCTG-23884722388481015-006-A10, AK066792, AK120532, J100083F02
 OsREG462AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG476 GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514  CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCACGC-23884892388501015-006-A10, AK066792, AK120532, J100083F02
 OsREG627TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602     GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGCGCACGCG-23885722388579015-006-A10, AK066792, AK120532, J100083F02
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.