version
PlantPromoterDB promoter information of AK071125

Summary of Gene (AK071125)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0652900        NCBI 
Gene model AK071125  
Description Peptidyl-tRNA hydrolase, PTH2 domain containing protein.  
#
#

Overview

Focused view (chromosome 4: 33660647-33659448)

Genome position     
from initiation codon
J023082K03          
J075104G16          
J075142E01          
TSS from cDNA
TSS information
AK071125                         5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071125

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-33659726-79

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCCC-3365969433659702-47-55
Y PatchCCTCCTCCC-3365974333659751-96-104
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCGTTGGGCCCACCTGTCAG-3365977833659799-131-152
 OsREG469AGCCGTTG               PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG              PPDB MotifCCAACGG  PLACE Motif 
 OsREG626    GTTGGGCC           PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG639     TTGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GGGCCCAC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628        GGCCCACC       PPDB MotifGCCCA  PLACE Motif 
 OsREG476         GCCCACCT      PPDB MotifGCCCA  PLACE Motif 
 OsREG514          CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436           CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501            CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551              CCTGTCAG PPDB Motif  PLACE MotifTGAC 
REGATCCCCCATCGGACGG-3365983033659845-183-198
 OsREG482ATCCCCCA         PPDB Motif  PLACE Motif 
 OsREG484       ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545        TCGGACGG PPDB Motif  PLACE Motif 
REGGCCACGTGTCG-3365987533659885-228-238
 OsREG507GCCACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509  CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG452   ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTGGGGCCCACGG-3365989433659906-247-259
 OsREG631GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG547     GCCCACGG PPDB MotifGCCCA  PLACE Motif 
REGACACGTGGC-3365991033659918-263-271
 OsREG434ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507 CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGGCCGGGC-3365993833659945-291-298
 OsREG614GGCCGGGC PPDB Motif  PLACE Motif 
REGGGGACCCA-3365999733660004-350-357
 OsREG637GGGACCCA PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.