version
PlantPromoterDB promoter information of AK071176

Summary of Gene (AK071176)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0704200        NCBI 
Gene model AK071176  
Description Zinc finger, MYND-type domain containing protein.  
#
#

Overview

Focused view (chromosome 3: 29073586-29072387)

Genome position     
from initiation codon
J023083O08          
TSS from cDNA
TSS information
AK071176                         5'->3' (-)
Promoter sequence







 
                    
Os03g0704300        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071176

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-29072699-113

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACACGTGGG-2907279029072799-204-213
 OsREG509GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG508  CACGTGGG PPDB MotifACGT  PLACE Motif 
REGGCCACGTGGGTCCCACC-2907282629072842-240-256
 OsREG507GCCACGTG          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG508  CACGTGGG        PPDB MotifACGT  PLACE Motif 
 OsREG622     GTGGGTCC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG637      TGGGTCCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648       GGGTCCCA   PPDB MotifGGGACCC  PLACE Motif 
 OsREG650        GGTCCCAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG651         GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGGTGTGGGC-2907297429072981-388-395
 OsREG598GTGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGGTGGATG-2907298729072994-401-408
 OsREG515GGTGGATG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.