version
PlantPromoterDB promoter information of AK071199

Summary of Gene (AK071199)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0828200        NCBI 
Gene model AK071199  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 36470888-36472087)

Genome position     
from initiation codon
003-107-H05         
J075023B21          
J075065K11          
J075116L02          
J075123G23          
J075183E14          
TSS from cDNA
TSS information
AK071199                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071199

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+36471823-65

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTC+3647185336471860-35-28
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACGGCCCAGA+3647166636471676-222-212
 OsREG645TACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629   GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTGCGGCCCACAGCCCAATA+3647168936471707-199-181
 OsREG643TGCGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA         PPDB MotifGCCCA  PLACE Motif 
 OsREG435        ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511         CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG460          AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596           GCCCAATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.