version
PlantPromoterDB promoter information of AK071230

Summary of Gene (AK071230)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0612800        NCBI 
Gene model AK071230  
Description Protein prenyltransferase domain containing protein.  
#
#

Overview

Focused view (chromosome 4: 31474314-31473115)

Genome position     
from initiation codon
016-010-G05         
TSS from cDNA
TSS information
AK071230                         5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071230

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-31474875-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGATGGGCCGAGCACGGCCCAAA-3147493231474955-68-91
 OsREG534TGGATGGG                 PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GGATGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GATGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG490   ATGGGCCG              PPDB MotifGCCCA  PLACE Motif 
 OsREG658    TGGGCCGA             PPDB MotifGCCCA  PLACE Motif 
 OsREG575     GGGCCGAG            PPDB MotifGCCCA  PLACE Motif 
 OsREG504             CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445              ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563               CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625                GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGCGATGGGCCTTGTAATGGGCCACGGCCCAACA-3147496531474996-101-132
 OsREG553CGATGGGC                         PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT                       PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT                      PPDB MotifGCCCA  PLACE Motif 
 OsREG497    GGGCCTTG                     PPDB MotifGCCCA  PLACE Motif 
 OsREG610            TAATGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG431             AATGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG488              ATGGGCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG653               TGGGCCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG521                   CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504                    CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445                     ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563                      CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626                       GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594                        GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGCGCGCGAC-3147512131475128-257-264
 OsREG557CGCGCGAC PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.