version
PlantPromoterDB promoter information of AK071500

Summary of Gene (AK071500)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0208000        NCBI 
Gene model AK071500  
Description Similar to 2-oxoglutarate/malate translocator.  
#
#

Overview

Focused view (chromosome 5: 6677679-6678878)

Genome position     
from initiation codon
009-045-D12         
016-011-B10         
AK059612            
AK063666            
J023042K16          
J023045L04          
J023093C11          
J023112P22          
J023132C02          
J033025I08          
J033124D14          
J043006H19          
J053063K22          
J075139D13          
J075142E02          
J075191A04          
J090011A08          
J090028I07          
J090076A08          
J090090G16          
J090095G03          
J100021M17          
J100034F11          
J100035H02          
J100048H20          
J100055C02          
J100063G08          
J100066N07          
J100069D18          
J100074L09          
J100086O09          
TSS from cDNA
TSS information
AK071500                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071500

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+6678546-133

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCTC+66785566678564-123-115
Y PatchCCTTCCTC+66785666678573-113-106
Y PatchCCTTCCTC+66785756678582-104-97
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACCA+66782786678286-401-393
 OsREG462AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599 GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGCCCACGGGCCCACCTGTCAGT+66783216678341-358-338
 OsREG531CCCACGGG              PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG566    CGGGCCCA          PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640     GGGCCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGCCCACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG476       GCCCACCT       PPDB MotifGCCCA  PLACE Motif 
 OsREG514        CCCACCTG      PPDB MotifGCCCA  PLACE Motif 
 OsREG436         CCACCTGT     PPDB Motif  PLACE Motif 
 OsREG501          CACCTGTC    PPDB Motif  PLACE Motif 
 OsREG551            CCTGTCAG  PPDB Motif  PLACE MotifTGAC 
 OsREG453             CTGTCAGT PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.