version
PlantPromoterDB promoter information of AK071536

Summary of Gene (AK071536)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0678600        NCBI 
Gene model AK071536  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 29677412-29678611)

Genome position     
from initiation codon
009-114-H06         
AK063019            
AK120629            
J013045E23          
J013153D21          
J013157A14          
J023048M04          
J065006P11          
J065042O14          
J065080D15          
J065096M02          
J065109M14          
J065204H02          
J065207L21          
J075028D22          
J075040O12          
J075051O03          
J075071M13          
J075151H15          
J075153D16          
J075153I21          
J080311L16          
J090039J19          
J100053A20          
J100071P19          
TSS from cDNA
TSS information
AK071536                         5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071536

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+29678164-248
TSS clone peakTclone+29678376-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTCTCTCTCTCTCCTC+2967835029678370-62-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCGGCCCAGC+2967802829678038-384-374
 OsREG575CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGCGCACCGC+2967818429678191-228-221
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGCTCTCCGC+2967823529678242-177-170
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGCCCCCGCG+2967825429678261-158-151
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGCGGGCCCGC+2967830329678312-109-100
 OsREG619GCGGGCCCGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.