version
PlantPromoterDB promoter information of AK071561

Summary of Gene (AK071561)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0163700        NCBI 
Gene model AK071561  
Description Similar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).  
#
#

Overview

Focused view (chromosome 5: 3714165-3712966)

Genome position     
from initiation codon
016-007-H11         
J013147O20          
J023099O18          
J033038F17          
J033118K07          
J043009L02          
J043036J01          
J065040A20          
J065063L12          
J065079M03          
J065080C23          
J065080C24          
J065120D08          
J065122G24          
J065138N05          
J065151P13          
J065166K19          
J065167C15          
J065186H09          
J065200H06          
J065209G17          
J075053F07          
J075072I11          
J075089J10          
J100043B20          
J100044E04          
J100044G05          
J100054K23          
J100059J16          
J100067J18          
J100074C18          
J100076M08          
J100080G19          
J100088K08          
J100090F15          
TSS from cDNA
TSS information
AK071561                         5'->3' (-)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071561

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-3713286-121

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCC-37132463713254-81-89
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACTGACAGGTGGGCCAGA-37133383713355-173-190
 OsREG453ACTGACAG           PPDB Motif  PLACE MotifTGAC 
 OsREG551 CTGACAGG          PPDB Motif  PLACE MotifTGAC 
 OsREG501   GACAGGTG        PPDB Motif  PLACE Motif 
 OsREG436    ACAGGTGG       PPDB Motif  PLACE Motif 
 OsREG514     CAGGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG476      AGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG654        GTGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577         TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638          GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGCCACCTGTCAGTGG-37133993713412-234-247
 OsREG436CCACCTGT       PPDB Motif  PLACE Motif 
 OsREG501 CACCTGTC      PPDB Motif  PLACE Motif 
 OsREG551   CCTGTCAG    PPDB Motif  PLACE MotifTGAC 
 OsREG453    CTGTCAGT   PPDB Motif  PLACE MotifTGAC 
 OsREG510     TGTCAGTG  PPDB Motif  PLACE MotifTGAC 
 OsREG522      GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGCACTGACAGGTGGGGCCCACGC-37134333713454-268-289
 OsREG510CACTGACA               PPDB Motif  PLACE MotifTGAC 
 OsREG453 ACTGACAG              PPDB Motif  PLACE MotifTGAC 
 OsREG551  CTGACAGG             PPDB Motif  PLACE MotifTGAC 
 OsREG501    GACAGGTG           PPDB Motif  PLACE Motif 
 OsREG436     ACAGGTGG          PPDB Motif  PLACE Motif 
 OsREG514      CAGGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG612        GGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631         GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641          TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647           GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640            GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571             GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602              GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGCCCCACGT-37134653713472-300-307
 OsREG450CCCCACGT PPDB MotifACGT  PLACE Motif 
REGCCACTGACACGTGGGTCCCACCAC-37135633713586-398-421
 OsREG522CCACTGAC                 PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA                PPDB Motif  PLACE MotifTGAC 
 OsREG509     GACACGTG            PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434      ACACGTGG           PPDB MotifACGT  PLACE Motif 
 OsREG508       CACGTGGG          PPDB MotifACGT  PLACE Motif 
 OsREG622          GTGGGTCC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG637           TGGGTCCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG648            GGGTCCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650             GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651              GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527                CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.