version
PlantPromoterDB promoter information of AK071621

Summary of Gene (AK071621)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0667600        NCBI 
Gene model AK071621  
Description Similar to Glycine decarboxylase complex H-protein.  
#
#

Overview

Focused view (chromosome 6: 28539129-28537930)

Genome position     
from initiation codon
AK058606            
J023101D03          
J033095E17          
J065020B16          
TSS from cDNA
TSS information
AK071621                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071621

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-28538168-39

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTCTCTCC-2853818928538203-60-74
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCATT-2853820828538217-79-88
 OsREG421AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCATTA-2853822228538233-93-104
 OsREG419AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432   AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610    GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCA-2853823928538246-110-117
 OsREG435ACAGCCCA PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCTA-2853825128538261-122-132
 OsREG437ACATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAATT-2853826428538272-135-143
 OsREG460AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433 GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-2853833828538345-209-216
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.