version
PlantPromoterDB promoter information of AK071624

Summary of Gene (AK071624)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0445700        NCBI 
Gene model AK071624  
Description Similar to LOB domain protein 39.  
#
#

Overview

Focused view (chromosome 3: 19573121-19571922)

Genome position     
from initiation codon
J023106M18          
J065178J05          
J065196F10          
TSS from cDNA
TSS information
AK071624                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071624

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-19572235-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTCTATATAGC-1957226019572271-139-150
Y PatchCCCTCCCCCTC-1957222219572232-101-111
Y PatchCCCTCCCC-1957225119572258-130-137
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAGGCCCCAG-1957240019572410-279-289
 OsREG524CCAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG580   GGCCCCAG PPDB Motif  PLACE Motif 
REGCCCCCGCG-1957241919572426-298-305
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCCGATCCGACGGCCCG-1957246119572476-340-355
 OsREG541CCGATCCG         PPDB Motif  PLACE Motif 
 OsREG588  GATCCGAC       PPDB MotifCCGAC  PLACE Motif 
 OsREG483   ATCCGACG      PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546    TCCGACGG     PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584       GACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446        ACGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGCCGAGCCG-1957249719572504-376-383
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGGCCCACCC-1957251419572521-393-400
 OsREG600GCCCACCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.