version
PlantPromoterDB promoter information of AK071625

Summary of Gene (AK071625)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0255200        NCBI 
Gene model AK071625  
Description Heat shock protein DnaJ, N-terminal domain containing protein.  
#
#

Overview

Focused view (chromosome 3: 8262926-8261727)

Genome position     
from initiation codon
AK058212            
J023106F16          
J033045K08          
J065152G18          
J090069I22          
J100039E12          
TSS from cDNA
TSS information
AK071625                         5'->3' (-)
Promoter sequence











 
                    
Os03g0255301        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK071625

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-8262576-650

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTTGGGCTGGGCCCAATT-82626198262637-693-711
 OsREG595GGTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT           PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG511  TTGGGCTG          PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG620      GCTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579       CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639         GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492          GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433           GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCAGGTGGGGCCCACTCC-82626528262668-726-742
 OsREG514CAGGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC        PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC       PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478       GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG532         CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGAGGGCCCACCTG-82627218262732-795-806
 OsREG475AGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514    CCCACCTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.